 |
Home | GBrowse | Clinical Data | Data Tables | Download | Resources | Links | For Families | ||||||||
| The Chromosome 7 Annotation Project |
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| Gene / Transcript Structure |
Click the image to go to the GBrowse |
| General information |
| Class | Gene_Segment |
| TCAG Gene ID | GA0641 [Old ID: HSC7000641] |
| Gene Symbol | TRBJ2-2 [HUGO ID: TRBJ2-2] |
| Gene Name | T cell receptor beta joining 2-2 |
| Synonyms | TCRBJ2S2, TRBJ22 |
| Gene Ontology | |
| Transcript | TRBJ2-2 | T00532 | TRBJ2-2 |
| External links |
| LocusLink | 28628 |
| RefSeq | |
| GenBank | U66061 [genome] X02987 [genome] |
| PubMed | 8650574, 2997718 |
| Transcript Sequence(s) |
| >T00532 Gene_ID:GA0641,Symbol:TRBJ2-2,Class:Gene_Segment,BaseSeq:TRBJ2-2 GGTTTGCGCCAGGGTCCCCAGGGCTGTGCGAACACCGGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGG |
Note: Some data originated from NCBI's LocusLink.